Problem 47513. DNA Sequence Assembly
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show commentsProblem Recent Solvers3
Suggested Problems
-
1470 Solvers
-
287 Solvers
-
Smallest distance between a point and a rectangle
275 Solvers
-
Back to basics 23 - Triangular matrix
1117 Solvers
-
String permutations on phone keyboard
24 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!