Does MATLAB have a function to write data / text to a specific field on a website

I want to write data to a website (https://rnacomposer.cs.put.poznan.pl/) that requires seperate lines of text. I want to test it out first doing one at a time and then switch to the batch file method. Does MATLAB have functions already developed to write to a website in this manner?

Answer 1

[Tanmay Das]

Hi,

You may use the "webwrite" function to write data to a website. You may specify field name and corresponding field value to fill the data in that particular field. Here is an example for your reference:

thingSpeakURL = 'http://api.thingspeak.com/';
thingSpeakWriteURL = [thingSpeakURL 'update'];
writeApiKey = 'Your Write API Key';
fieldName = 'field1';
fieldValue = 42;
response = webwrite(thingSpeakWriteURL,'api_key',writeApiKey,fieldName,fieldValue)

[Stephen Hummel]

I was trying to implement the webwrite function using a struct for the data to be input into the primary field. However, I consistently recieved an error. Is webwrite the best option for this process? Or do I have the weboptions constructed wrong? I am trying to get this simple test case to work so I can build a larger function to run batch files. Thank you.

The code I used was:

url = 'https://rnacomposer.cs.put.poznan.pl/';

TestSequence =

struct with fields:

Name: 'TestSequence'

Sequence: 'GCUCCUAGAAAGGCGCGGGCCGAGGUACCAAGGCAGCGUGUGGAGC'

Structure: '(((((.......((((..(((..........))).))))..)))))'

weboptions.KeyName = 'input';

weboptions.KeyValue = TestSequence;

options = weboptions;

>> response = webwrite(url, options)

[Sivani Pentapati]

Hi Stephen,

The Media Type for a structure has to be set to 'json' in the weboptions as you are passing a structure in webwrite function. Please find the below code to write the TestSequence structure as JSON object.

url = 'https://rnacomposer.cs.put.poznan.pl/';
TestSequenc.Name = 'TestSequence';
TestSequence.Sequence = 'GCUCCUAGAAAGGCGCGGGCCGAGGUACCAAGGCAGCGUGUGGAGC';
TestSequenceStructure: '(((((.......((((..(((..........))).))))..)))))';
options = weboptions('MediaType', 'application/json');
response = webwrite(httpsUrl, employee, options)