Text and Characters
R2026bText in String Arrays
When you are working with text, enclose sequences of characters in double quotes. You can assign text to a variable.
t = "Hello, world";If the text includes double quotes, use two double quotes within the definition.
q = "Something ""quoted"" and something else."q =
"Something "quoted" and something else."
t and q are arrays, like all MATLAB® variables. Their class or data type is
string.
whos tName Size Bytes Class Attributes t 1x1 174 string
To add text to the end of a string, use the plus operator,
+.
f = 71; c = (f-32)/1.8; tempText = "Temperature is " + c + "C"
tempText = "Temperature is 21.6667C"
Similar to numeric arrays, string arrays can have multiple elements. Use the
strlength function to find the length of each string within
an
array.
A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
A =
2×3 string array
"a" "bb" "ccc"
"dddd" "eeeeee" "fffffff"
strlength(A)
ans =
1 2 3
4 6 7
Data in Character Arrays
Sometimes characters represent data that does not correspond to text, such as a
DNA sequence. You can store this type of data in a character array, which has data
type char. Character arrays use single
quotes.
seq = 'GCTAGAATCC'; whos seq
Name Size Bytes Class Attributes seq 1x10 20 char
Each element of the array contains a single character.
seq(4)
ans =
'A'
Concatenate character arrays with square brackets, just as you concatenate numeric arrays.
seq2 = [seq 'ATTAGAAACC']seq2 =
'GCTAGAATCCATTAGAAACC'
Character arrays are common in programs that were written before the introduction
of double quotes for string creation in R2017a. All MATLAB functions that accept string data also accept
char data, and vice versa.