how to convert a long list into an array with semicolongs
Show older comments
I'm pretty new to MatLab but while this seems very simple I can't find an answer
I am downloading amino acid or nucelotide sequences from the NIH data base, and these appear like
CGTGAATACAAAAATATGCCAGCTTGCTAATATAATAACGATGTTTTCAAATCCATTAAGTTAACAACAA
that go on for hundreds or thousands of letters
I'm using each letter to trigger a different event, in this case play a different sound
to do so I need each letter separated by a semicolon, which I believe makes it a separate row in an array
is there an instruction that will take a string of letters as above and insert a semicolon between the letters?
thanks very much, Dave
Answers (2)
Hi!
What exactly do you need? Do you have a loop for playing sounds according to the letters?
for n = 1:length(str)
switch (str(n))
case 'C'
% play a C
case 'G'
% play a G
case 'T'
% play a T
case 'A'
% play a A
end
end
Categories
Find more on Genomics and Next Generation Sequencing in Help Center and File Exchange
Products
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!