Main Content

Text in String and Character Arrays

R2026b

There are two ways to represent text in MATLAB®. You can store text in string arrays and in character vectors. MATLAB displays strings with double quotes and character vectors with single quotes.

Represent Text with String Arrays

You can store any 1-by-n sequence of characters as a string, using the string data type. Enclose text in double quotes to create a string.

str = "Hello, world"
str = 
"Hello, world"

Though the text "Hello, world" is 12 characters long, str itself is a 1-by-1 string, or string scalar. You can use a string scalar to specify a file name, plot label, or any other piece of textual information.

To find the number of characters in a string, use the strlength function.

n = strlength(str)
n = 
12

If the text includes double quotes, use two double quotes within the definition.

str = "They said, ""Welcome!"" and waved."
str = 
"They said, "Welcome!" and waved."

To add text to the end of a string, use the plus operator, +. If a variable can be converted to a string, then plus converts it and appends it.

fahrenheit = 71;
celsius = (fahrenheit-32)/1.8;
tempText = "temperature is " + celsius + "C"
tempText = 
"temperature is 21.6667C"

You can also concatenate text using the append function.

tempText2 = append("Today's ",tempText)
tempText2 = 
"Today's temperature is 21.6667C"

The string function can convert different types of inputs, such as numeric, datetime, duration, and categorical values. For example, convert the output of pi to a string.

ps = string(pi)
ps = 
"3.1416"

You can store multiple pieces of text in a string array. Each element of the array can contain a string having a different number of characters, without padding.

str = ["Mercury","Gemini","Apollo";...
       "Skylab","Skylab B","ISS"]
str = 2×3 string
    "Mercury"    "Gemini"      "Apollo"
    "Skylab"     "Skylab B"    "ISS"   

str is a 2-by-3 string array. You can find the lengths of the strings with the strlength function.

N = strlength(str)
N = 2×3

     7     6     6
     6     8     3

String arrays are supported throughout MATLAB and MathWorks® products. Functions that accept character arrays (and cell arrays of character vectors) as inputs also accept string arrays.

Represent Text with Character Vectors

To store a 1-by-n sequence of characters as a character vector, using the char data type, enclose it in single quotes.

chr = 'Hello, world'
chr = 
'Hello, world'

The text 'Hello, world' is 12 characters long, and chr stores it as a 1-by-12 character vector.

whos chr
  Name      Size            Bytes  Class    Attributes

  chr       1x12               24  char               

If the text includes single quotes, use two single quotes within the definition.

chr = 'They said, ''Welcome!'' and waved.'
chr = 
'They said, 'Welcome!' and waved.'

Character vectors have two principal uses:

  • To specify single pieces of text, such as file names and plot labels.

  • To represent data that is encoded using characters. In such cases, you might need easy access to individual characters.

For example, you can store a DNA sequence as a character vector.

seq = 'GCTAGAATCC';

You can access individual characters or subsets of characters by indexing, just as you would index into a numeric array.

seq(4:6)
ans = 
'AGA'

Concatenate character vector with square brackets, just as you concatenate other types of arrays.

seq2 = [seq 'ATTAGAAACC']
seq2 = 
'GCTAGAATCCATTAGAAACC'

You can also concatenate text using append. The append function is recommended because it treats string arrays, character vectors, and cell arrays of character vectors consistently.

seq2 = append(seq,'ATTAGAAACC')
seq2 = 
'GCTAGAATCCATTAGAAACC'

MATLAB functions that accept string arrays as inputs also accept character vectors and cell arrays of character vectors.

See Also

| | | | | |

Topics